Jump to content

Search the Community

Showing results for tags 'animation'.



More search options

  • Search By Tags

    Type tags separated by commas.
  • Search By Author

Content Type


Forums

  • Max3D.pl
    • Aktualności (mam newsa)
  • Graphics
    • Work in progress (WIP)
    • Animacje
  • Dyskusje
    • Hardware
    • Dyskusje o grafice
    • Wolne dyskusje
    • Komentarze, propozycje ...
  • Pytania i odpowiedzi
    • 3ds max
    • Maya
    • Blender
    • Sculpting
    • Cinema 4D
    • Photoshop
    • Substance Designer / Painter
    • Inne
  • Ogłoszenia
    • Praca Oferowana (bez ogłoszeń FREE)
  • Archiwum
    • Archiwum (2000-2019)
    • Konkursy

Find results in...

Find results that contain...


Date Created

  • Start

    End


Last Updated

  • Start

    End


Filter by number of...

Joined

  • Start

    End


Group


About Me


Miasto


pkt.

Found 38 results

  1. Studio animacji Deep Blue, zajmujące sie produkcją cinematików do gier komputerowych i filmowych efektów specjalnych poszukuje kandydatów na stanowisko: Animator do stałej współpracy w naszym studio w Warszawie. Zadania: Animacja postaci w cinematikach do gier komputerowych i w ujęciach VFX zgodnie z wytycznymi reżysera Tworzenie animacji postaci ludzkich, zwierząt, potworów i pojazdów Współpraca kreatywna z reżyserem na etapie preprodukcji, previsu i animacji Wymagane: Maya Demoreel 5 lat doświadczenia w VFX, grach lub posprodukcji jako animator postaci Mile widziane: Motion Builder Doświadczenie w pracy z motion capture Doświadczenie w tworzeniu animatików Oferujemy: Wynagrodzenie od 6 000 do 10 000 pln netto miesięcznie w zależności od doświadczenia Udział w ciekawych, złożonych projektach z obszaru animacji i filmu Długoterminowy kontrakt 20 dni płatnego urlopu Możliwość pracy z doświadczonym zespołem weteranów Prace przy ciekawych projektach, opierających się o animacje postaci i fotorealistyczny rendering Możliwość pracy przy różnorodnych projektach z pogranicza game dev'u i filmu Możliwość rozwoju i nauki Przyjazną atmosferę kilkunastoosobowego zespołu Zainteresowane osoby prosimy o wypełnienie formularza na stronie: https://www.deep-blue.com/jobs Jeśli wolisz wysłać CV i portfolio prosto do nas, potrzebujesz dowiedzieć się więcej lub chcesz tylko się przywitać, pisz na [email protected] Więcej informacji znajdziesz na naszym profilu na Facebooku. Pamiętaj o załączeniu klauzuli: “Wyrażam zgodę na przetwarzanie moich danych osobowych dla potrzeb niezbędnych do realizacji procesu rekrutacji (zgodnie z Ustawą z dnia 29.08.1997 roku o Ochronie Danych Osobowych; tekst jednolity: Dz. U. 2016 r. poz. 922).”
  2. Cześć! Chcielibyśmy zaprezentować Wam nasz najnowszy REEL na 2019 rok. 60 sekund animacji FULL CGI dla takich marek jak Electrolux, AEG, JIVR, Geberit, Danforce, Powerlix, Omron, Koło, Excellent czy Brighter. [video=youtube;hUjdYtv-WqY] C&C mile widziane! Koniecznie odwiedźcie naszą stronę internetową oraz profil na behancie
  3. Studio animacji Deep Blue, zajmujące sie produkcją cinematików do gier komputerowych i filmowych efektów specjalnych poszukuje kandydatów na stanowisko Rigger: Zadania: Tworzenie rigów złożonych postaci hi-poly Codzienne wsparcie animatorów Praca nad pipelinem animacji i innymi rozwiązaniami technicznymi Wymagane: Maya Demoreel Doświadczenie na stanowsku TD w VFX, grach lub postprodukcji Mile widziane: Python lub Mel Doświadczenie w rigowaniu twarzy Doświadczenie z motion capture Doświadczenie w symulacji tkanin Oferujemy: Wynagrodzenie od 6 000 do 9000 pln netto miesięcznie w zależności od doświadczenia Udział w ciekawych, złożonych projektach z obszaru animacji i filmu Długoterminowy kontrakt 20 dni płatnego urlopu Możliwość pracy z doświadczonym zespołem weteranów Prace przy ciekawych projektach, opierających się o animacje postaci i fotorealistyczny rendering Możliwość pracy przy różnorodnych projektach z pogranicza game dev'u i filmu Możliwość rozwoju i nauki Przyjazną atmosferę kilkunastoosobowego zespołu Zainteresowane osoby prosimy o wypełnienie formularza na stronie: https://www.deep-blue.com/jobs Jeśli wolisz wysłać CV i portfolio prosto do nas, potrzebujesz dowiedzieć się więcej lub chcesz tylko się przywitać, pisz na [email protected] Więcej informacji znajdziesz na naszym profilu na Facebooku. Pamiętaj o załączeniu klauzuli: “Wyrażam zgodę na przetwarzanie moich danych osobowych dla potrzeb niezbędnych do realizacji procesu rekrutacji (zgodnie z Ustawą z dnia 29.08.1997 roku o Ochronie Danych Osobowych; tekst jednolity: Dz. U. 2016 r. poz. 922).”
  4. psotnik: człowiek lubiący psoty, figlarz; przedstawiciel rzędu drobnych owadów posiadających narządy gębowe gryzące; gryzek Początki przygód Psotnika sięgają 2014 roku, kiedy to powstał jako dwutygodniowy wolny projekt. Po dwóch latach przerwy wrócił jako 2-3 dniowe okolicznościowe realizacje. Jednak konwencja przygód "okołodupowych" i żartów na jak najniższym poziomie żenady, pozostała ta sama. Niespodziewanie przed świętami udało mi się ukończyć trzecią przygodę Psotnika i wbrew głosowi rozsądku, postanowiłem tą oto trylogią się podzielić. Jestem też świadomy różnych błędów i niedociągnięć technicznych, ale w tak krótkim czasie nie sposób jest wszystko dopiąć idealnie. Zapraszam zatem do oglądania i mam nadzieję, że niesmak nie pozostanie na długo: 01. Nie psoć, Psotniku! 02. Nic się nie stało Psotniku! 03. Wesołych Świąt, Psotniku! [video=youtube;wnxeC5g-HaY] Jeśli ktoś chce jeszcze coś gorszego zobaczyć, to tu taki archiwalny wątek sprzed paru lat: http://max3d.pl/forum/threads/92531-Dziura-absurdalny-serial-animowany-(dla-starszych)-NOWY-ODCINEK-14-02!?highlight= pozdrawiam!
  5. Witam bardzo serdecznie, Prosił bym o pomoc w stworzeniu animacji i nadaniu temu modelowi życia. Chcę aby mógł chodzić, skakać czy też tańczyć. Obejrzałem parę poradników na ytubie ale wciąż nie jestem w stanie tego ogarnąć :( Do wymodelowania dłoni użyłem programu ZBrush po czym zmniejszyłem liczbę poligonów tak aby było ich jak najmniej. Po czym nadałem kości w Maya i przypisałem konkretne części modelu do konkretnych kości. Rotując kości model się porusza lecz kości zostają w tym samym miejscu. Jak mogę sprawić aby nie było tych dziur?
  6. Hej, wrzucam tutaj moje pierwsze ujęcie z wykorzystaniem dialogu, pomyślałem że zna pewno znajdzie się tu ktoś kto podzieli się dobrą radą :) https://www.youtube.com/watch?v=R0NzsueLFsc&feature=youtu.be
  7. bolekcg

    Magic Forest

    * MAGIC FOREST * Magic forest to krótka historia o urokach i pokusach zaczarowanego lasu. Główni bohaterowie, szalona i nieposkromiona Wiewiórka zaprasza swojego przyjaciela Zająca do przeżycia niezapomnianej przygody w tytułowym lesie. Bohaterowie oddają się pokusom zaczarowanego lasu, lecz sielanka i radość w pewnym momencie dobiega końca, a ich przyjaźń zostaje wystawiona na próbę. Magic forest to gorzka historia w lukrowej polewie, opowieść o wyborach i sile pożądania. Autor Ot i nasza krwawica:) Gratuluje , dziękuje wszystkim wytrwałym i pracowitym ludziom którzy przyczynili się do powstania tego shorta. Nie pozostaje nic innego jak powiedzieć że w końcu! I nigdy, nigdy więcej :) Tak całkiem serio to kawal ciężkiej lekcji dla całego zespołu, ale myślę że było warto, bo sporo się nauczyliśmy. Zapraszam. https://www.facebook.com/magicforestmovie http://www.magicforestmovie.com/
  8. Witam Poszukuję rozwiązania mojego aktualnie tematu który jest dość problematyczny dla mnie ze względu na poziom trudności... Przedstawię swój problem: Potrzebuję zrobić animacje materaca, na który upadnie manekin czy piłka obojętne. Ale muszę zrobić to w ten sposób by upadek na materac był realistyczny pod względem tego jak sam materac będzie się zaginać w tym momencie. Proszę o wszelkie wskazówki, tutoriale. Będę zobowiązany, uratujecie mi życie ;) edit. Maya tez wchodzi w grę Pozdrawiam i liczę na szybką pomoc.
  9. Witam, jestem animatorem 2d i przedstawiam Wam moją najnowszą(i nie tylko) produkcję. Jeden Wał i Osiou - jak nazwa podpowiada - to przygoda pewnej trójki niezrównoważonych osobników mieszanego pochodzenia, którzy mają bardzo przyszłościowe plany co do świata. Ambitne pomysły naukowca, Człowieka Osła, mają być realizowane z pomocą Człowieka Zemba (zęba) i Człowieka Wałka - dwóch niezbyt inteligentnych osób, których wyobrażenie świata przedstawia grupę w takim, a nie innym świetle. Pierwsza część ich przygód jest już na naszych oczach, w której znaleźli sposób na... Sam zobacz!
  10. Hej! Chciałbym wam zaprezentować krótką animację jaką popełniłem pod okiem doktora biotechnologi. Jest to nasza pierwsza tego typu praca i traktowaliśmy to jako poszukiwanie koncepcji więc jakikolwiek feedback pozytywny jak i negatywny jest mile widziany :). O ile prywatny czas pozwoli to planujemy jeszcze kilka małych projektów związanych z edukacją itp. Link do Video: https://vimeo.com/149039755 Jakby ktoś chciał poczytać to zapraszam na naszego bloga: https://biopressjournal.wordpress.com/ Z technicznych spraw. Soft: Maya, Blender (gównie UV i poprawianie tekstur), Mental Ray, Vray, After Effect, Photoshop. Starałem się uzyskać optymalne czasy renderów na poziomie 10-15min na klatkę. Sporo pythona i mel. Model jak i rig DNA jest generowany na podstawie ciągu znaków odpowiadających sekwencji nukleotydów np. inputMtx=‘ACAAGATGCCATTGTCCCCCGGCC’. Parametry dotyczące helisy DNA zaczerpnięte ze strony http://www.rcsb.org (kąty, odległości itp.) Krótka prezentacja możliwości rigu i i skryptów na poniższym video: Behance z ujęciami w HQ: https://www.behance.net/gallery/32758367/PFGE-Animation pozdrawiam.
  11. Krótki animacyjny demo reel z pierwszej połowy 2015 roku https://www.behance.net/prace09 Pozdrawiam
  12. The PolyForge is a game-art production studio based in Brisbane, Australia. We have recently established our second studio in Warsaw, and we are looking for talented and versatile 3d artists to join our team and help produce 3d art for some of the most prominent studios in the world. We are offering full-time positions in our Warsaw studio (permanent as well as contract). To be considered, applicants must provide a portfolio link showing sample work. Requirements: - Strong knowledge of 3DS Max, Blender or similar - Strong knowledge of Adobe Photoshop - Ability to create realistic and stylised assets to a very high standard, as demonstrated by online portfolio. - Understanding of normal map creation process - Understanding of PBR workflow - Understanding of effective topology and UV layouts - Must speak fluent English Responsibilities: - Produce hard-surface and organic models from concept art and reference materials - Produce models consistent with various art styles as determined by client requirements - Complete tasks within assigned timeframes and to a consistently high standard. - Respond to feedback from Senior Artists and Art Director, and adapt work accordingly Experience is the following fields is beneficial, but not required: - Experience with Unreal Engine, CryEngine and Unity - Experience using Quixel Suite - Rigging and animation experience - 2D and concept art experience To apply for this position please send your CV and portfolio link to [email protected]
  13. CZeść wszytskim. Miał ktos z was takiego buga?? https://drive.google.com/file/d/0BzvGTjn7BJSOMXRkeWthSDBKVlE/view . Spowodowane jest to animownś skalą w drugim evencie. Instatn object to point cache. Za cholere nie moge usunć tego charakterystycznego tikniecie, zresztą widac ktorego. Screenschot drzewka https://drive.google.com/file/d/0BzvGTjn7BJSOcUc4RVdZX1hUOUU/view . Za wszeslkie info duże piwo. Pzdr
  14. Nowy reel, stary był za stary i trzeba było coś nowego skleić. Animacje wykonywane w 3dsmax i maya. Rigi to CAT i custom rigi. edit: po kilku poradach oraz ocenach reela postanowiłem go poprawić.
  15. Witam chciałbym zaprezentować krótką animacje mego autorstwa pt. "Wild_East" . Zachecam do oglądania oraz komentowania, bo chetnie posłucham każdej uwagi i krytyki. Przepraszam również na wstępie za jakość, ale animacja tworzona na średniej jakości pececie (intel quad 4x 2.4, 4GB RAm, geforce 9800GT)i na większą jakość renderingu niestety nie mogłem sobie pozwolić głównie z braku czasu. Projekt „Wild East” to próba sprawdzenia siebie z wiedzy o grafice trójwymiarowej jaką nabyłem na przestrzeni ostatnich dwóch lat. Przez ten czas interesowałe m się głównie dziedziną modelingu, texturowania oraz techniczną stroną grafiki 3D. Ostatnie pięć miesięcy to okres, w którym intensywnie pracowałem aby ostatecznie móc zaprezentować swoje umiejętności tworząc autorską, w pełni trójwymiarową animację. Inspiracją do stworzenia animacji były filmy z gatunku western, ukazujące rzeczywistość dzikiego zachodu, męskość, bezkompromisowość, a także konflikty miedzy dwoma walczącymi stronami. Animacja przenosi nas w czasy dzikiego zachodu. Charakterystyczny dla tego okresu klimat ma ukazać sposób rozwiązywania konfliktów miedzy najbardziej znaczącymi osobami. Tym sposobem jest pojedynek strzelecki miedzy dwoma kowbojami, z którego wyjść cało może tylko jeden. Ostatecznie akcja przybiera jednak inną formę, gdyż oboje wychodzą cało z potyczki oszukani przez mechanizm napędzający świat, który sami stworzyli. Moim zamierzeniem było by animacja odnosiła sie do dzisiejszych czasów i świata, w którym żyjemy, gdzie odbywa sie wiele konfliktów militarnych, politycznych oraz katastrof, które decydują o faktycznym stanie gospodarki. Nasuwa się tutaj powiedzenie: „Gdzie dwóch się bije, tam trzeci korzysta". Uważam, iż to przysłowie doskonale wpasowuje się w obecną sytuację na świecie, w którym nieszczęście i strata jednego przynosi korzyści drugiemu. https://www.youtube.com/watch?v=ZNeBDSPgnRg Pozdrawiam
  16. Witajcie, mam szkielet o standardowej hierarchii typu: Bip01 --Bip01 Pelvis itp. itd. Bip01 zawiera animację zmieniającą position i rotation. To co chciałbym osiągnąć to skopiować rotation z Bip01 do Bip01 Pelvis, jednocześnie usuwając ją z Bip01. Czyli w Bip01 pozostaje position, a do Pelvis zostaje przeniesione rotation. Do tej pory po prostu kopiowałem keyframe'y w Curve Editor, ale jest problem: po skopiowaniu model zaczyna się dziwnie obracać, w dziwne strony, zupełnie inaczej niż było to w Bip01. Warto zaznaczyć ze Bip01 i Bip01 Pelvis jest dokładnie w tym samym miejscu w przestrzeni. Problem nie musi być do końca tak przedstawiony jak opisałem wyżej. Najistotniejsze jest to, aby w pierwszej kości (root) znajdowała się informacja tylko o position (czyli bez rotation), a jednocześnie chciałbym żeby animacja wyglądała identycznie jak przed transformacją, czyli w grę wchodzi również dodanie nowej root bone. Jest mi to potrzebne do silnika gier Unreal Engine, ponieważ chcę skorzystać z Root Motion, a specyfika tego silnika pozwala tylko na zmianę position w root bone. Więc to w zasadzie tyle... Może się zmienić nawet cały szkielet, chcę tylko aby animacja wyglądała tak samo jak pierwotnie, ale w root bone, żeby była tylko informacja o animacji position. Mam nadzieję, że wyjaśniłem to w miarę sensownie i mi pomożecie, bo męczę się nad tym już 2 tygodnie i przeczesałem chyba cały internet, a podejrzewam, że dla Was jest to proste zagadnienie, dlatego zdecydowałem się napisać. Nie mam już chyba innych pomysłów. Będę bardzo wdzięczny za pomoc i z góry dziękuję.
  17. Siemka:) Wrzucam kolejną animację nad którą ślęczałem od końca Stycznia. Początkowo zrobiona na Styczniową rywalizację 11 Second Club, później wykańczana po godzinach w wolnym czasie, jeśli już taki się nadarzył. Startując w Styczniowej rywalizacji rozpocząłem projekt jakieś 5 dni przed deadlinem, tak wiem mało czasu, ale to troszeczkę motywowało aby zrobić jak najlepiej, co niestety nie wyszło. Tempo oraz jakość animacji przełożyła się na 80 miejsce w końcowych wynikach. Nie jestem za dobrym aktorem co widać, odegrałem scenkę aby mieć "dobre" referencje i widocznie zbyt mocno się jej trzymałem. Będąc niezadowolony z jakości uznałem że trzeba to jakoś ogarnąć i dopracować. Po odrobinie przerwy (hmmm kilka tygodni może?;), w wolnych chwilach małymi kroczkami wykańczałem animację. Zajęło mi to z grubsza ok 32h (to "około" to dość luźne pojęcie ponieważ nie zapisywałem kiedy i ile siedziałem nad animacją). Efekt możecie obejrzeć poniżej. Jak zawsze uwagi mile widziane:) Ps. Na moim blogu albo vimeo możecie obejrzeć wcześniejszą wersję, która poleciała na głosowanie w styczniu.
  18. Cześć! Oto najnowsza produkcja opowiadająca o Otwartej Platformie Komunikacji Wewnętrznej - Erudion. Mile widziane słowa krytyki ;) Wybrane kadry Pozdr Norbert
  19. Cześć, Jesteśmy Studio BX z Warszawy. Zrobiliśmy animowane intro do gry Anomaly 2 studia 11 Bit Studios. pozdro! Vimeo: Behance: http://www.behance.net/gallery/Anomaly-2-Cinematic-Intro/8573283
  20. Witam. Chciałem ustawić birth w ten sposób, żeby tworzyło cząsteczki powiedzmy co 5 klatek przez 1 klatkę. Wiem że da się to zrobić, ale kompletnie nie wiem jak się do tego zabrać
  21. Witam serdecznie, bardzo pilnie potrzebuję pomocy w wykonaniu podobnej animacji. Chodzi mianowicie o wykorzystanie linii (najlepiej importowanych w formacie .dwg) do stworzenia animacji tworzenia się rur. Animacja posiadać będzie dużo tego typu obiektów tworzących się podczas jej trwania, także byłoby świetnie gdyby rendering nie zabił komputerów i nie trwał 3lata :)) Pomysł tego projektu odnosi się do budowania obiektu (hotelu) i napełniania go wszelkiego rodzaju instalacjami, w celu uświadomienia przyszłych studentów Architektury Wnętrz jak wiele "żył i tętnic" potrzebuje budynek by ożyć. Najbardziej zależy mi na sposobie możliwie najprostszym. Serdecznie pozdrawiam i dziękuje z góry za wszelką pomoc! BARDZO PROSZĘ więc rady i pomysły dotyczące zaanimowania danego kształtu po linii przy pomocy 3dsmax'a lub dodatkowo AfterEffects.
  22. Witam serdecznie. Przytrafił mi się szybki tutorial dotyczący animacji 2d. Trochę chaotyczny bo robiony na szybko, ale mam nadzieję, że kilka informacji da się wyłapać. Pozdrawiam! :)
  23. Witam. Właśnie skończyłem pracę nad animacją poklatkową-CV. Zajęło mi to mniej więcej 6 godzin, i było bardzo męczące. Całość malowana jest farbami plakatowymi( najtańszymi w m1) na ścianie, a na koncu jeszcze przyklejane kartki :) http://www.youtube.com/watch?v=em3Ja7QMpuE
  24. Witam, ostatnio zainteresował mnie pewien efekt oglądająć teledysk Jest tam pokazany tj. efekt rosnącego kryształu. Czy ktoś wie jak można taki efekt uzyskać do animacji? (Przepraszam jeśli zły dział) Program 3d Max 12 + Mental Ray Pozdrawiam
×
×
  • Create New...

Important Information

We are using cookies. Read about our Privacy Policy