Jump to content

Search the Community

Showing results for tags 'animation'.



More search options

  • Search By Tags

    Type tags separated by commas.
  • Search By Author

Content Type


Forums

  • Max3D.pl
    • Aktualności (mam newsa)
  • Graphics
    • Work in progress (WIP)
    • Animacje
  • Dyskusje
    • Hardware
    • Dyskusje o grafice
    • Wolne dyskusje
    • Komentarze, propozycje ...
  • Pytania i odpowiedzi
    • 3ds max
    • Maya
    • Blender
    • Sculpting
    • Cinema 4D
    • Inne
  • Ogłoszenia
    • Praca Oferowana (bez ogłoszeń FREE)
  • Archiwum
    • Archiwum (2000-2019)
    • Konkursy

Find results in...

Find results that contain...


Date Created

  • Start

    End


Last Updated

  • Start

    End


Filter by number of...

Joined

  • Start

    End


Group


Miasto


pkt.

Found 48 results

  1. Loozack

    Luxury watch 01

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  2. Loozack

    Luxury watch 02

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  3. Loozack

    Luxury watch 03

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  4. Loozack

    Luxury watch 04

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  5. Loozack

    Luxury watch 05

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  6. Loozack

    Luxury watch 06

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  7. Loozack

    Luxury watch 07

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  8. Loozack

    Luxury watch wire 01

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  9. Loozack

    Luxury watch wire 02

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  10. Loozack

    Luxury watch wire 03

    From the album: Luxury watch | CGI

    © Copyright Dabarti

  11. Studio animacji Deep Blue, zajmujące sie produkcją cinematików do gier komputerowych i filmowych efektów specjalnych poszukuje kandydatów na stanowisko: Animator do stałej współpracy w naszym studio w Warszawie. Zadania: Animacja postaci w cinematikach do gier komputerowych i w ujęciach VFX zgodnie z wytycznymi reżysera Tworzenie animacji postaci ludzkich, zwierząt, potworów i pojazdów Współpraca kreatywna z reżyserem na etapie preprodukcji, previsu i animacji Wymagane: Maya Demoreel 5 lat doświadczenia w VFX, grach lub posprodukcji jako animator postaci Mile widziane: Motion Builder Doświadczenie w pracy z motion capture Doświadczenie w tworzeniu animatików Oferujemy: Wynagrodzenie od 6 000 do 10 000 pln netto miesięcznie w zależności od doświadczenia Udział w ciekawych, złożonych projektach z obszaru animacji i filmu Długoterminowy kontrakt 20 dni płatnego urlopu Możliwość pracy z doświadczonym zespołem weteranów Prace przy ciekawych projektach, opierających się o animacje postaci i fotorealistyczny rendering Możliwość pracy przy różnorodnych projektach z pogranicza game dev'u i filmu Możliwość rozwoju i nauki Przyjazną atmosferę kilkunastoosobowego zespołu Zainteresowane osoby prosimy o wypełnienie formularza na stronie: https://www.deep-blue.com/jobs Jeśli wolisz wysłać CV i portfolio prosto do nas, potrzebujesz dowiedzieć się więcej lub chcesz tylko się przywitać, pisz na [email protected] Więcej informacji znajdziesz na naszym profilu na Facebooku. Pamiętaj o załączeniu klauzuli: “Wyrażam zgodę na przetwarzanie moich danych osobowych dla potrzeb niezbędnych do realizacji procesu rekrutacji (zgodnie z Ustawą z dnia 29.08.1997 roku o Ochronie Danych Osobowych; tekst jednolity: Dz. U. 2016 r. poz. 922).”
  12. Cześć! Chcielibyśmy zaprezentować Wam nasz najnowszy REEL na 2019 rok. 60 sekund animacji FULL CGI dla takich marek jak Electrolux, AEG, JIVR, Geberit, Danforce, Powerlix, Omron, Koło, Excellent czy Brighter. [video=youtube;hUjdYtv-WqY] C&C mile widziane! Koniecznie odwiedźcie naszą stronę internetową oraz profil na behancie
  13. Studio animacji Deep Blue, zajmujące sie produkcją cinematików do gier komputerowych i filmowych efektów specjalnych poszukuje kandydatów na stanowisko Rigger: Zadania: Tworzenie rigów złożonych postaci hi-poly Codzienne wsparcie animatorów Praca nad pipelinem animacji i innymi rozwiązaniami technicznymi Wymagane: Maya Demoreel Doświadczenie na stanowsku TD w VFX, grach lub postprodukcji Mile widziane: Python lub Mel Doświadczenie w rigowaniu twarzy Doświadczenie z motion capture Doświadczenie w symulacji tkanin Oferujemy: Wynagrodzenie od 6 000 do 9000 pln netto miesięcznie w zależności od doświadczenia Udział w ciekawych, złożonych projektach z obszaru animacji i filmu Długoterminowy kontrakt 20 dni płatnego urlopu Możliwość pracy z doświadczonym zespołem weteranów Prace przy ciekawych projektach, opierających się o animacje postaci i fotorealistyczny rendering Możliwość pracy przy różnorodnych projektach z pogranicza game dev'u i filmu Możliwość rozwoju i nauki Przyjazną atmosferę kilkunastoosobowego zespołu Zainteresowane osoby prosimy o wypełnienie formularza na stronie: https://www.deep-blue.com/jobs Jeśli wolisz wysłać CV i portfolio prosto do nas, potrzebujesz dowiedzieć się więcej lub chcesz tylko się przywitać, pisz na [email protected] Więcej informacji znajdziesz na naszym profilu na Facebooku. Pamiętaj o załączeniu klauzuli: “Wyrażam zgodę na przetwarzanie moich danych osobowych dla potrzeb niezbędnych do realizacji procesu rekrutacji (zgodnie z Ustawą z dnia 29.08.1997 roku o Ochronie Danych Osobowych; tekst jednolity: Dz. U. 2016 r. poz. 922).”
  14. psotnik: człowiek lubiący psoty, figlarz; przedstawiciel rzędu drobnych owadów posiadających narządy gębowe gryzące; gryzek Początki przygód Psotnika sięgają 2014 roku, kiedy to powstał jako dwutygodniowy wolny projekt. Po dwóch latach przerwy wrócił jako 2-3 dniowe okolicznościowe realizacje. Jednak konwencja przygód "okołodupowych" i żartów na jak najniższym poziomie żenady, pozostała ta sama. Niespodziewanie przed świętami udało mi się ukończyć trzecią przygodę Psotnika i wbrew głosowi rozsądku, postanowiłem tą oto trylogią się podzielić. Jestem też świadomy różnych błędów i niedociągnięć technicznych, ale w tak krótkim czasie nie sposób jest wszystko dopiąć idealnie. Zapraszam zatem do oglądania i mam nadzieję, że niesmak nie pozostanie na długo: 01. Nie psoć, Psotniku! 02. Nic się nie stało Psotniku! 03. Wesołych Świąt, Psotniku! [video=youtube;wnxeC5g-HaY] Jeśli ktoś chce jeszcze coś gorszego zobaczyć, to tu taki archiwalny wątek sprzed paru lat: http://max3d.pl/forum/threads/92531-Dziura-absurdalny-serial-animowany-(dla-starszych)-NOWY-ODCINEK-14-02!?highlight= pozdrawiam!
  15. Witam bardzo serdecznie, Prosił bym o pomoc w stworzeniu animacji i nadaniu temu modelowi życia. Chcę aby mógł chodzić, skakać czy też tańczyć. Obejrzałem parę poradników na ytubie ale wciąż nie jestem w stanie tego ogarnąć :( Do wymodelowania dłoni użyłem programu ZBrush po czym zmniejszyłem liczbę poligonów tak aby było ich jak najmniej. Po czym nadałem kości w Maya i przypisałem konkretne części modelu do konkretnych kości. Rotując kości model się porusza lecz kości zostają w tym samym miejscu. Jak mogę sprawić aby nie było tych dziur?
  16. Hej, wrzucam tutaj moje pierwsze ujęcie z wykorzystaniem dialogu, pomyślałem że zna pewno znajdzie się tu ktoś kto podzieli się dobrą radą :) https://www.youtube.com/watch?v=R0NzsueLFsc&feature=youtu.be
  17. bolekcg

    Magic Forest

    * MAGIC FOREST * Magic forest to krótka historia o urokach i pokusach zaczarowanego lasu. Główni bohaterowie, szalona i nieposkromiona Wiewiórka zaprasza swojego przyjaciela Zająca do przeżycia niezapomnianej przygody w tytułowym lesie. Bohaterowie oddają się pokusom zaczarowanego lasu, lecz sielanka i radość w pewnym momencie dobiega końca, a ich przyjaźń zostaje wystawiona na próbę. Magic forest to gorzka historia w lukrowej polewie, opowieść o wyborach i sile pożądania. Autor Ot i nasza krwawica:) Gratuluje , dziękuje wszystkim wytrwałym i pracowitym ludziom którzy przyczynili się do powstania tego shorta. Nie pozostaje nic innego jak powiedzieć że w końcu! I nigdy, nigdy więcej :) Tak całkiem serio to kawal ciężkiej lekcji dla całego zespołu, ale myślę że było warto, bo sporo się nauczyliśmy. Zapraszam. https://www.facebook.com/magicforestmovie http://www.magicforestmovie.com/
  18. Witam Poszukuję rozwiązania mojego aktualnie tematu który jest dość problematyczny dla mnie ze względu na poziom trudności... Przedstawię swój problem: Potrzebuję zrobić animacje materaca, na który upadnie manekin czy piłka obojętne. Ale muszę zrobić to w ten sposób by upadek na materac był realistyczny pod względem tego jak sam materac będzie się zaginać w tym momencie. Proszę o wszelkie wskazówki, tutoriale. Będę zobowiązany, uratujecie mi życie ;) edit. Maya tez wchodzi w grę Pozdrawiam i liczę na szybką pomoc.
  19. Witam, jestem animatorem 2d i przedstawiam Wam moją najnowszą(i nie tylko) produkcję. Jeden Wał i Osiou - jak nazwa podpowiada - to przygoda pewnej trójki niezrównoważonych osobników mieszanego pochodzenia, którzy mają bardzo przyszłościowe plany co do świata. Ambitne pomysły naukowca, Człowieka Osła, mają być realizowane z pomocą Człowieka Zemba (zęba) i Człowieka Wałka - dwóch niezbyt inteligentnych osób, których wyobrażenie świata przedstawia grupę w takim, a nie innym świetle. Pierwsza część ich przygód jest już na naszych oczach, w której znaleźli sposób na... Sam zobacz!
  20. Hej! Chciałbym wam zaprezentować krótką animację jaką popełniłem pod okiem doktora biotechnologi. Jest to nasza pierwsza tego typu praca i traktowaliśmy to jako poszukiwanie koncepcji więc jakikolwiek feedback pozytywny jak i negatywny jest mile widziany :). O ile prywatny czas pozwoli to planujemy jeszcze kilka małych projektów związanych z edukacją itp. Link do Video: https://vimeo.com/149039755 Jakby ktoś chciał poczytać to zapraszam na naszego bloga: https://biopressjournal.wordpress.com/ Z technicznych spraw. Soft: Maya, Blender (gównie UV i poprawianie tekstur), Mental Ray, Vray, After Effect, Photoshop. Starałem się uzyskać optymalne czasy renderów na poziomie 10-15min na klatkę. Sporo pythona i mel. Model jak i rig DNA jest generowany na podstawie ciągu znaków odpowiadających sekwencji nukleotydów np. inputMtx=‘ACAAGATGCCATTGTCCCCCGGCC’. Parametry dotyczące helisy DNA zaczerpnięte ze strony http://www.rcsb.org (kąty, odległości itp.) Krótka prezentacja możliwości rigu i i skryptów na poniższym video: Behance z ujęciami w HQ: https://www.behance.net/gallery/32758367/PFGE-Animation pozdrawiam.
  21. Krótki animacyjny demo reel z pierwszej połowy 2015 roku https://www.behance.net/prace09 Pozdrawiam
  22. The PolyForge is a game-art production studio based in Brisbane, Australia. We have recently established our second studio in Warsaw, and we are looking for talented and versatile 3d artists to join our team and help produce 3d art for some of the most prominent studios in the world. We are offering full-time positions in our Warsaw studio (permanent as well as contract). To be considered, applicants must provide a portfolio link showing sample work. Requirements: - Strong knowledge of 3DS Max, Blender or similar - Strong knowledge of Adobe Photoshop - Ability to create realistic and stylised assets to a very high standard, as demonstrated by online portfolio. - Understanding of normal map creation process - Understanding of PBR workflow - Understanding of effective topology and UV layouts - Must speak fluent English Responsibilities: - Produce hard-surface and organic models from concept art and reference materials - Produce models consistent with various art styles as determined by client requirements - Complete tasks within assigned timeframes and to a consistently high standard. - Respond to feedback from Senior Artists and Art Director, and adapt work accordingly Experience is the following fields is beneficial, but not required: - Experience with Unreal Engine, CryEngine and Unity - Experience using Quixel Suite - Rigging and animation experience - 2D and concept art experience To apply for this position please send your CV and portfolio link to [email protected]
  23. CZeść wszytskim. Miał ktos z was takiego buga?? https://drive.google.com/file/d/0BzvGTjn7BJSOMXRkeWthSDBKVlE/view . Spowodowane jest to animownś skalą w drugim evencie. Instatn object to point cache. Za cholere nie moge usunć tego charakterystycznego tikniecie, zresztą widac ktorego. Screenschot drzewka https://drive.google.com/file/d/0BzvGTjn7BJSOcUc4RVdZX1hUOUU/view . Za wszeslkie info duże piwo. Pzdr
  24. Nowy reel, stary był za stary i trzeba było coś nowego skleić. Animacje wykonywane w 3dsmax i maya. Rigi to CAT i custom rigi. edit: po kilku poradach oraz ocenach reela postanowiłem go poprawić.
  25. Witam chciałbym zaprezentować krótką animacje mego autorstwa pt. "Wild_East" . Zachecam do oglądania oraz komentowania, bo chetnie posłucham każdej uwagi i krytyki. Przepraszam również na wstępie za jakość, ale animacja tworzona na średniej jakości pececie (intel quad 4x 2.4, 4GB RAm, geforce 9800GT)i na większą jakość renderingu niestety nie mogłem sobie pozwolić głównie z braku czasu. Projekt „Wild East” to próba sprawdzenia siebie z wiedzy o grafice trójwymiarowej jaką nabyłem na przestrzeni ostatnich dwóch lat. Przez ten czas interesowałe m się głównie dziedziną modelingu, texturowania oraz techniczną stroną grafiki 3D. Ostatnie pięć miesięcy to okres, w którym intensywnie pracowałem aby ostatecznie móc zaprezentować swoje umiejętności tworząc autorską, w pełni trójwymiarową animację. Inspiracją do stworzenia animacji były filmy z gatunku western, ukazujące rzeczywistość dzikiego zachodu, męskość, bezkompromisowość, a także konflikty miedzy dwoma walczącymi stronami. Animacja przenosi nas w czasy dzikiego zachodu. Charakterystyczny dla tego okresu klimat ma ukazać sposób rozwiązywania konfliktów miedzy najbardziej znaczącymi osobami. Tym sposobem jest pojedynek strzelecki miedzy dwoma kowbojami, z którego wyjść cało może tylko jeden. Ostatecznie akcja przybiera jednak inną formę, gdyż oboje wychodzą cało z potyczki oszukani przez mechanizm napędzający świat, który sami stworzyli. Moim zamierzeniem było by animacja odnosiła sie do dzisiejszych czasów i świata, w którym żyjemy, gdzie odbywa sie wiele konfliktów militarnych, politycznych oraz katastrof, które decydują o faktycznym stanie gospodarki. Nasuwa się tutaj powiedzenie: „Gdzie dwóch się bije, tam trzeci korzysta". Uważam, iż to przysłowie doskonale wpasowuje się w obecną sytuację na świecie, w którym nieszczęście i strata jednego przynosi korzyści drugiemu. https://www.youtube.com/watch?v=ZNeBDSPgnRg Pozdrawiam
×
×
  • Create New...

Important Information

We are using cookies. Read about our Privacy Policy