Jump to content

Marvin

Members
  • Content Count

    293
  • Joined

  • Last visited

  • Days Won

    3

Everything posted by Marvin

  1. Czyli pomijając naszą nostalgię, istnieje dziura na rynku? Jakie powinny być założenia i funkcje takiego serwisu?
  2. Żeby nie zdziczeć robiąc freelance w piwnicy należy dbać o higienę pracy i work/life balanace. Poradników jest sporo ale chyba najważniejsze jest to by rekompensować sobie samotny czas pracy z rodziną i znajomymi. Plus jakieś sekcje sportowe w grupie a nie samemu na siłowni odbębniać trening i na chatę :D. Choć niektórym izolacja nie sprawia większych problemów albo żyją w swojej iluzji.
  3. Za mało danych by odpowiedzieć na twoje pytanie. Z grafiką sprawa jest prosta: Jak coś umiesz i jesteś w stanie to dobrze zaprezentować (portfolio, demoreel), praca sama ciebie znajdzie. Zawód ten można też wykonywać zdalnie w międzynarodowych projektach więc demografia nie ma tutaj znaczenia.
  4. Może za mało precyzyjnie opisałem. Z mojej perspektywy to wygląda tak, że mogę pisać toolsy ale nie widziałbym się jako osoba, która przez cały czas robi tylko to. Jakoś mam większą motywację pisząc coś co sam użyję, coś co ułatwi mi pracę i jednocześnie pozwoli brać aktywny udział w tworzeniu ujęć :) Etap projektowania jest super, fajnie się robi prototypy itp. Natomiast wdrażanie tego na produkcję to już nie moja para kaloszy.
  5. “ Y U NO LEARN?! :)” Może dlatego, że nie wydaje się to ciekawe? Chyba po coś wybraliśmy grafikę 3d i animację :). Jakby moja praca polegała głównie na kodowaniu i czytaniu bibliotek to bym zmienił branżę na bardziej elastyczną (IT jest mega chłonne). Do tego materiały do nauki zupełnie zniechęcają. No i strasznie ubogie możliwości w projektowaniu ładnego UI.
  6. Do artykułu dodał bym jeszcze wzmiankę o serwisie Newgrounds i jego wpływie na rozwój animacji. Ten video esej bardzo dobrze podsumowuje czym jest ten serwis.
  7. Justice League jest starszy niż Avengers. Chyba seria filmów tylko o Batmanie sprawiła, że dziwnie się patrzy na jego współpracę z innymi bohaterami. W przypadku komiksu czy serii animowanej to nikogo nie dziwi. W sumie ciekawe co tu się będzie działo po pierwszym trailerze Infinity War. Dla niewtajemniczonych to w jednym filmie zobaczymy: Avengers, Guardians Of The Galaxy, Spider Man, Dr. Strange i kilku Xmanów.
  8. http://tick.wikia.com/wiki/Chairface_Chippendale
  9. Lucas przed SW zrobił American Graffiti (gdzie zagrał Harrison Ford). Ryan Reynolds też przed Deadpoolem był mocno znany. Bliższym porównaniem z ostaniach lat jest District 9. Budżet 30M$, nieznany reżyser (choć jego reklamy były dość mocno znane w środowisku 3d), zero sławnych aktorów. Wracając do tematu GITS. Dziwni mnie sposób promocji filmu. Pierwszy raz się spotykam z sytuacją gdzie taka liczba making offów, materiałów behind the scenes itp. wypływa z długo przed premierą. Trochę mnie to martwi bo mam wrażenie, że dostajemy na tacy wszystkie najlepsze sceny. No i fraza z trailera "They did not save your life. They stole it." wywołuje u mnie grymas na twarzy bo dostajemy sugestię, że fabuła gits zostanie mocno spłycona do typowego filmu o agencie, który dowiaduje się, że organizacja dla której pracuje jest be. No ale to tylko trailer.
  10. heh. Z tym tosterem to celowe? Pamiętam jaką traumę u dzieci robiła animacja Brave little toster http://www.imdb.com/title/tt0092695/ :) Ciekawi mnie bardzo jaki jest odbiór szerszej grupy bo muszę przyznać, że już od pierwszych screenów uszatka bije niepokojący mroczny klimat głównie spowodowany dużą ilością czerni.
  11. Pytaj tu: http://soup-dev.websitetoolbox.com/
  12. Heja, dzięki za fronta :). Udało mi się doprowadzić projekt do końca i animacja doczekała się profesjonalnego lektora: pozdrawiam, K.
  13. Double Commander (darmowy) Sortujesz folder wg. daty. Zaznaczasz pliki wewnątrz folderu (ctrl+A), files -> multi rename tool, Mask: 'File Name': nazwa_sekwencji[C] . W zakładce Counter ustawiasz format (np. Width 03 -> 001,002,003) W total commanderze jest podobnie.
  14. Ograniczyłem się do zrobienia prezentacji skryptów i rigu bo to jedyne elementy które nie są standardowe w tym projekcie. No chyba, że masz pytania o jakieś konkretne rzeczy to pisz. Postaram się odpowiedzieć.
  15. Hej! Chciałbym wam zaprezentować krótką animację jaką popełniłem pod okiem doktora biotechnologi. Jest to nasza pierwsza tego typu praca i traktowaliśmy to jako poszukiwanie koncepcji więc jakikolwiek feedback pozytywny jak i negatywny jest mile widziany :). O ile prywatny czas pozwoli to planujemy jeszcze kilka małych projektów związanych z edukacją itp. Link do Video: https://vimeo.com/149039755 Jakby ktoś chciał poczytać to zapraszam na naszego bloga: https://biopressjournal.wordpress.com/ Z technicznych spraw. Soft: Maya, Blender (gównie UV i poprawianie tekstur), Mental Ray, Vray, After Effect, Photoshop. Starałem się uzyskać optymalne czasy renderów na poziomie 10-15min na klatkę. Sporo pythona i mel. Model jak i rig DNA jest generowany na podstawie ciągu znaków odpowiadających sekwencji nukleotydów np. inputMtx=‘ACAAGATGCCATTGTCCCCCGGCC’. Parametry dotyczące helisy DNA zaczerpnięte ze strony http://www.rcsb.org (kąty, odległości itp.) Krótka prezentacja możliwości rigu i i skryptów na poniższym video: Behance z ujęciami w HQ: https://www.behance.net/gallery/32758367/PFGE-Animation pozdrawiam.
  16. Marvin

    Maya help

    co tu się dzieje? za pierwszym razem miałem 2x Windows Menu. za drugim 2x Air. :D
  17. Ja od nich :D Tak gdzieś w okolicach marzec - czerwiec pracowałem nad animacją związaną z doświadczeniami na nici DNA Still . W tym czasie powstał pomysł zrobienia czegoś bardziej 'organicznego' zupełnie niezwiązanego z rzeczywistością. Początkowo wzorowałem się na Prometeuszu ale Ares bardziej mi podpasował kompozycją. Właściwie animka jest skutkiem ubocznym znalezienia praktycznego użycia nodów SOuP'a i przećwiczenia render / compo.
  18. Super. Bardzo przyjemnie się ogląda. Mam takie małe pytanie do twórców czy dobrze czuję: Kapitan Bomba, Rafał Sonik, Black Mirror (odcinek świąteczny)? :)
  19. To zależy co byś chciał w 3d robić. Jakiś czas temu Albert z naszego forum popełnił taki artykuł, który może Ci nakreślić ile jest działów w 3d: http://max3d.pl/artykuly/6635/stanowiska-vfx-hierarchia-i-nazewnictwo-stanowisk-w-pracy-zwiazanej-z-efektami-specjalnymi . Moje podejście jest takie by mieć umiejętności z każdego działu pozwalające samodzielnie zrobić prosty projekt. Do tego znaleźć sobie jeden dział taki, przy którym praca sprawia największa satysfakcję i starać się dążyć w nim do jak najwyższego poziomu (sky is the limit). Co do oprogramowania to dla freelancera do przygotowywania assetów i prostych animacji zestaw budżetowy Blender + Substance dają radę. Sam nie używam ale znam kilka osób co wykonują na tym zlecania do dużych projektów.
  20. Pytania były zadawane na Youtubowym czacie i bardzo szybko wyłapywane przez prowadzących. Duży plus dla organizatorów :)
  21. Nie spodziewałem się, że kolejnego shorta SF o strzelaniu w opuszczonych budynkach będę mógł oglądać bez przewijania. Ładne to to i przemyślane. :)
  22. hej, wrzucam krótkie ujęcie, nad którym siedziałem po nocach kilka tygodni. Głównym zamysłem projektu było stworzenie bliżej nieokreślonej biomasy, która ma zostać zainfekowana i dynamicznie się rozerwać na strzępy. Przy okazji mogłem przećwiczyć praktyczne użycie wielu nodów SOuP’a pod maya, trochę skryprowania w Python, render w Vray oraz compo. Soft: Maya, Vray, Blender, Zbrush, Photoshop, After Effect. Link do ujęcia: https://vimeo.com/147405505 Przygotowałem jeszcze krótki making off / breakdown z pracy nad ujęciem: https://vimeo.com/147259447 Dżwięk na szybko w Ableton Live: http://i.imgur.com/SWyt4TA.jpg Planuję jeszcze kilka projektów związanych z budowaniem organicznego świata więc jakiekolwiek komentarze czy pytania techniczne mile widziane :) pozdr.
  23. Zapoznaj się z metodą tworzenia IK/FK blending. W skrócie tworzysz 3 szkielety. W twoim przypadku będzie to 1. Szkielet pod animację ręczną. (input A) 2. Szkielet pod rozpad / symulację (input B) 3. Szkielet do skinowania. (output) Jak chcesz animować ręcznie rozpad to nawet wystarczyłby 1 szkielet z odpowiednią hierarchią jointów. Jeżeli chcesz używać symetrii w skinowaniu to najprostszą metodą jest scalenie modelu do jednej siatki i używanie opcji w stylu 'mirror skin weights'.
×
×
  • Create New...

Important Information

We are using cookies. Read about our Privacy Policy